passwdalias

a flowrl project

Entry #366

1257 hints 20 guesses

jaja alo all code 14725836965965856 :) subindo o tc Numeros sobe farah147258 ciudad ..... 12456789 9??? 123654 OYE repeticao dsds bonjour 654890 mano derecha kerlan fsdfdsfsdfdsfsfdsfdsfdsfsdfdsfdsfsdfdsfsdfdsfdfsfd clavier 456789321258 standar 1254 258369 de arriba numeros 0 nocqvaaki 1to9 th 123456789 Everywhere radja Software up3 147****** 172839 ni hao bryan147258369 leehtomadon 123321 song 963852741 789456123 ldoejld NUMERO Demerde toi a de sempre aim password facebook Morle 456987 lo de siempre ma 1+1 ivanshupakgrd La de siempre 4845 adrian y vania 555555555 dana murtdd karalho jhi what is 147... fila de numeros 2312 14730000 deatlove anjing wenaw numeros? car lisa tenkey numeros y nombre caramelo 11111111 msn?? how r u 0147258369 NumberUp teclado numerico keypad up 123s 01230123 142536 DESDE? 1123 canela qwertyuiop carla youness richitar 31229*** Special sequence Nurse cat Numeros subindo jesus vai se fuder mounir abc about keyboard meus numeros abi orde rezgre 123456789123456789123456789 nommers escola josej gi laticinha tzutzu ******* samarafatta babbu toiu 1234564 aaaaaa 147.369 1234 1~9 momin85 la de siempre!!^^ K orkut- numeros marta moura leo gladys FACEBOOK ?????????? ???????? ZZ linda_@hotmail.com alwase t vira 22222 321654986 SIG inversez les nombre a la suite mima conta 1n up 082009 fritsons sikandar gislaine bou hellohi 14728369 boi numero! 1 to 9 numup numere noi :)) 14725... Ripcurl NumPad ??? ?????? calculettte love haa canim sancen asd novia 147258369+- ************* dwn up sequencia do teclado Olha no print na pasta invisivel :D hint? pokiruxi 5176858 kolom1 1906 number up 12345678910 jeanfran down to top my number siempre 9 Numeros todo lo demas 9L 156 meu numero duda solotua maroc 963852741 backkwards no c msn msm music peru ahhh ########## essamahmedbashir m9 calculator ezjoni shanice Revers from 9 1472****9 sanane aqswde senha do msn aguilar haha numerodesiempre HACIA ARRIBA hemligt eenvierzeven twee vijf acht etc det jeg plejer caca Hinties dios cuchicuchi com dab easiest hola chirre none jajaj mariluise a senha e numero nerdisim badboybill mo the same as orkut vaynet 23wer nda 1+1= nine s?radan Password silent killer azimuddin2015 la de siempre something abcd f1 aassdd wang YO liuxin 555 Numbers Direction benz hahahah sad fuck numbres uai filadaputa 1314 numbers jeweet wel boven naar beneden 753951 msn pass serial counting Numero de telefono 562651414556 StarCraft cso hhh NUMBER PAD 25082345 132456789 de code 1 how hot akram son los numeros elephant 159357 nombre pumbi sequenciia sim pizza ngngcc 147 619 okay Comme d'hab wheredoyoulive mi kallampa cipari Cijfers mutar numeros para arriba solita 14.... minha senha padrao 2178283 lololo numb ?lkjhgfdsa klan muddy 123654789 nacimiento abdo lollol uma quatro maks-simka suji skysky dffgfdg Num Lock Normal claire quantos number la misma indiraa _ 147 sa virginiagatagatagatagatagatagatagatagatagatagataga adsasd 147? asmah mikaela 147258369thao photoshop help mery des numeros over teclas neta niko 14725836 Jayxxx keineahnung gshgsd das selbe blos lang hallo love number sequencia igual da loira Numeros de arriba abajo 50555 !+1=? reboza dioporco 25251325 lw 159 shuzi THE SAME ONETONINE numeros 1a9 ad?n ne mail carola tu la sabes kissy altijd hetzelfde 14725836914725836914725836914725836914725836914725 joao123 mert5fa yo soon8644 nada cascarrabias xanga 455 underground 193754628 camila numbers on the side of keyboard cer kiss NOMBRE majiang basem numbers 147------------ de 1 a 9 zig zag 456464 F@ber388 KEYBOARD name lies a7mad always gfgfgfg emed Teclado 12300 2515925 147258369369258147 los numeros um quatro sete dois cinco oito tres seis nove upupup oui nedfortsepd adobe Numeritos MIA asdfghghj fish NUMEROS sdfg dfg fg sdfsdf dd f echo07ps just the numbers secuencia 369258147 lala Dogs name eu et sayy?? 123456 todo skaiciai uuuu de1a9 vertigo USAKO aninhalima matriz 555555 pantuflo Haha wss itsumono 987654321 muraticaaa vito1472582369 gokhan perro 7 147258365 numeros do teclado la misma de simpre 718293 270809 common 147147 cary la solita campanita147258369 Gabih852 adivina q? ivan 0987379755592 arqam ni shi shui mmm 10101010 cookie La misma 147258368 okkk maite BRADA Block holacaracola lady gaga 147 g rakamlar gu1z3lm3 Nathi AZERTY 14725 david dfhdfh birthday 147......... Alckor 23111987 yun 123456789147258369 Nathy ehab ahnsohee1 Eliana zxcvbnm,.123 go up in number tenis moimem wwwcom numeros a la inversa nhm = msn lululululu sanana number rafik one shugriya ik ben xD Enneagram Circuit jogo soso tel misu Adobe cs5 f(x)=123x^2 59862146325987462515 guess gatoperro birdortyediikibessekizucalt?dokuz seq 183 748159263 ser? kod bisssssbisssss kenway 1 up all of them bikao solito mama 1122 D_N_ meme a Nummer negre sifren? nomer sokeetva hicham azael tastatur k ti ? nunmeros largos 30051984 ermodel crown victoria the shit gore dole 13 12 15 14 17 man2 amanha sei la roberto tommy 252525 duiker Num blabla satria 18021987 12345 ZARD who are you num lock 19822891 kalki Som altid tal er vejen frem 956178 9num abajo para arriba YOUXIANGMIMA peravia de haut en bas dass casamalbeclote03 teclado moimm1 loko 1skiptwo 0000000 wthomas numlock al.bark jianpan 111111111 147258369? 1472583691 1472583690 es idiota los numeros 1615 - nyrt 123456789123456789 what's your numbers 147258369josyok zaferrrraza Numeros de baixo pra cima. 147258369. 000000000 112233 Te amo nancy saaaaaaaaaaaaay?????? normal code luca-gardien GOD meadd/giildcps crisha sharpay147 nin dewam? asdasd nitin lolzi madremia Num Lock dois what's your pass 123678 258147369 QQ as_1472 cima la contrase?a es de los numeros nombre maimdoasjd 000000 gaby kk a mesma 1234himo dog 147.... number keys kp .gp ya ves nanhexin 147258369a password is 147258369 my name? usual kamel farrapo ???/ NumberPad numero de puta fabiooo Sedat lovelove tu numero de todo nbaerfffff Sequncie Numeros cima solomobile tkt Clavier ojo cp pass uv3753 degicafe What Is My Pass ? desenho tecladoo 4679 zahl fecha mascota junior 04.08.1997 baixo cima sobedesce e361232@bsnow.net U U U 10?? verticales1-2-3 telefono ied nuttapon 11 hotmail Numara Dayy honda keyboard number mgm da numberos Thu.PeQe! 123 kilany a mesma que a do euro gunz!! de arriba hacia abajo smtzttn who are u sen ben?ms?n qq 198612 fgfgdfgfgsdfg 123123 somshi 12345678910111213 teclas up 33124 gever ssdfsddf JKHBJK 19 teclado9 federman bestsinger 147258367 rebote fhrtsg x schatz numeros faciles zelfde als a4u n aleatorias up down keypad seguencia de numeros 159357456 teclado arriba num sean nel culu sport numeros seguidos gmail khmercambodia # i suck 147???369 102030 147....69 nummerblock wow kool NuMerOS fatos younsinho genius asa?? yukar? 369 pilastine-7oura who am i? old msn password email fdt 55555555 felype 3636 xDD 147258 vertical web wo s susriatidasimah abcdefghijklmn?opqrstuvwxyzabcdefghijklmn?opqrstuv key pad rakam dsgsdgsdg wq letras Dmitry come Rack fhbsjksjsgsdg biasa cos hahaha mino arriba_derecha 1 segue 2 segue 3 segue OAIidshSUADG conceito sparta Zahlen 789 1 a 3 deus_hudson@hotmail.com numbas 123456789 solo q para arriba see Adobe in cardfile numeros para arriva hamishegi n KILLBILL sempre pe sadas secreta sao os nove algarismos aa 5232847 pajooheshgar 121314 claveocd lomaslindo 1472581425 orkut desyrre 1a8 amina 258 nathi1 akasatana1979 kolomrij poh luis holahola emais aaaaaaaaa reverphotostudio 100 asdf logic Tmts gimhui 1425 jesuslindao 00 Brasfoot 111222333 Juh pagina web master numeros 1264147258369 . arta 147258? 3517218 atakan Numbers 147258369000 vanligt losen + en rad till puto Pet as alws numeric 1212 1 4 7 2 5 8..... juninho 0000 A 14327065 email pw taiseer arriba y abajo Wellington pista 123456789 UP my num 1505122378965 battleon up and right no se gfd gsdf Normal Ola No one my love wfl numver tastiera maviegem@hotmail.com azerty Number one to nine chamai AAssDD112233 number1 gne edmar non-ya jfl cijfers mammy name 6211600 Naah chiffre down to up senha orkut LOL asdfdgdfgfg blah numba nove digitos senha tuyyo chiffres numeros arriba cpss coco33 nahashon de la suerte 1472583699 LETTERS 251436 troya xxxyyy benim sifre ortas?nda 258 MOI same compte bien Seguida vertical 9 party the smae one as always suurei todos numero de sempre 1-9 anka balbla ball axyz taiz keys 147...369 numerical Barcelona Nada nix 000 never numbers1to7 sz,mz nem sei baixo cima lado lado imie ? 0167468183 gujjar 9 numbers ibolarff likeit keybord lucky normal for adobe 147258xxx yergenbab keypads gatinho 0102825922 san teste the sekuencia 147258369147258369147258369 tito le tsisy mahay lo que todos somos uasya fyfyj zxcvbnm go up money infosack65 kalo jeje ma samo redom lucas0071 Ahmed Omar dfgdfgdfdfg rim tim tim la misma del msn acm1pt hollo abiddd debile Sudoku hjj nicolas alper Hotmail 02020 hint ahaha vida Cifre ! rosa iuiung batata ruan 1112 3 sworpu asdqwexzcx up til vinstri 1468654 miosolo Primer Jefe. Armando P. sonia how are you osman s?ral? duzen birden dokuza kaanlan Sempre mop 147258369147 nicolly Key Pad moi facebook pasword mon linda fivi aaa klavye standart pw 02164562437 d Numerik htryjty sifror asda minininh0cps 50 ninguna 741852963 56449879849849546549689879846546546896849846912646 963852147aocontrario amor todo el teclado what key? password hint 147258369-1 14BLA ... 1597538752 muneros 14... number pad what sdfsdf 987 asdvfdfadas numeros de baixo para cima comme dhab homo 111 StarCraft ICCUP 147...... pala anhemmotnha peter ups mother was rien hoang aly dl pet sylOX simplE 1 fox legal erryh sil3ntslay3rz numeri ladesiempre Hi Aalst 3419559 420 alperalper saad say? UP3 1258 nose bd zaqxswcde matheus96 run Tall!! netwolfs 1588 N?got litet skitlosenord haha xD Hemma Serial no Heeeej hhdfhf tid numero polaco judson nqam ;) pmcc bokamaon Hello kendall wath my personal number? stone dio cane? ok oi koukou 1234567891 1234567890 Jade 1234567 en donde estudias Up and down. MYLOVE 33451561 Apo kato pros ta pano digits14 Rapa revolucion x wie immer ????9 creatif jimmy letters weet ik wel ola tongshang kimico 147258237456 ahm nummers les chifre a coter FeRRy memleket aqwzsxedc ur usual nu,ber password serhat greenforce 1987 art derbeder ma-jan dwd lok cabesa hey lol halla sequencia 2 kurosakiluo joseph palomino mpol ziffernblock todas 159357123456789 yo k se happy 4566545 coolio wagner_rangel bierre 123456789987654321 jajjaja 0248 curso web the password is 147258369 saebnh paula0001 GoGo tequiero 163 hi Shura_13 1 al 9 ubliches-1 asdfghjk Z DFG 14725836910 count 1024 musik ronaldo avni147 1029 tandinho ladone karaman55orhan paulojeruel numlook how are you mr awad abu shakfa imran mmmmm vuonggiathy seis letras no sea loco 111444777 hysin del 1al9 para arriva aw12345 157 up i dont chak gbfdh 112 chan what i allways use TOMOMI kkkkk koko dog name caracter ind keyboard num bellota num. fd na ja hiphip lalala yok LoveLVOe smun no tarc TT parecida a la de youtube tc la del mu 1111 9431312717 43155 special boon nemer tenkey all vertical up 159753 nu majyan 12345789 numerique patates crisse cristiano junn No. Keyboard ;lp; la misma ql msn lacka 123789 jhhh AV euuuuu adaA kokoayia Mot de passe blog asddsasd phone Win alert2 akela de smp 1592625 i?????? u jesusanderson huihu n? n0 2008 nasi 17447474 hello do 1 ao 9 num1